Rat 4-1BB/TNFRSF9/CD137 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001025773.1

RefSeq ORF Size

777bp

Gene Synonym

4-1BB, MGC114552, Tnfrsf9

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 9 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated T lymphocytes, which belongs to the tumor necrosis factor (TNF) receptor superfamily. It is expressed mainly on activated CD4+ and CD8+ T cells, and binds to a high-affinity ligand (4-1BBL) expressed on several antigen-presenting cells such as macrophages and activated B cells. Upon ligand binding, 4-1BB is associated with the tumor necrosis factor receptor–associated factors (TRAFs), the adaptor protein which mediates downstream signaling events including the activation of NF-kappaB and cytokine production. 4-1BB signaling either by binding to 4-1BBL or by antibody ligation delivers signals for T-cell activation and growth, as well as monocyte proliferation and B-cell survival, and plays an important role in the amplification of T cell-mediated immune responses. In addition, CD137 and CD137L are expressed in different human primary tumor tissues, suggesting that they may influence the progression of tumors. Crosslinking of CD137 on activated T cells has shown promise in enhancing anti-tumor immune responses in murine models, and agonistic anti-CD137 antibodies are currently being tested in phase I clinical trials.

References

Sica G, et al. (1999) Biochemical and immunological characteristics of 4-1BB (CD137) receptor and ligand and potential applications in cancer therapy. Arch Immunol Ther Exp (Warsz). 47(5): 275-9.

Nam KO, et al. (2005) The therapeutic potential of 4-1BB (CD137) in cancer. Curr Cancer Drug Targets. 5(5): 357-63.

Wang Q, et al. (2008) Analysis of CD137 and CD137L expression in human primary tumor tissues. Croat Med J. 49(2): 192-200.

Melero I, et al. (2008) Multi-layered action mechanisms of CD137 (4-1BB)-targeted immunotherapies. Trends Pharmacol Sci. 29(8): 383-90.

Thum E, et al. (2009) CD137, implications in immunity and potential for therapy. Front Biosci. 14: 4173-88.

Catalog Number:HGA041-CF