Rat VCAM1/VCAM-1/CD106 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:FGI330-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2220bp
Gene Synonym
VCAM1B, MGC108734, Vcam1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat vascular cell adhesion molecule 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.
References
  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • TOP