Ferret UBCH8 / UBE2L6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Ferret

NCBI Ref Seq

XM_004777586.1

RefSeq ORF Size

462bp

Gene Synonym

UBE2L6

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Ferret Mustela putorius furo (sub-species: furo) ubiquitin-conjugating enzyme E2L 6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

UBCH8, also known as UBE2L6, belongs to the ubiquitin-conjugating enzyme family. The family of ubiquitin-conjugating (E2) enzymes is characterized by the presence of a highly conserved ubiquitin-conjugating (UBC) domain. These domains accommodate the ATP-activated ubiquitin (Ub) or ubiquitin-like (UBL) protein via a covalently linked thioester onto its active-site residue. E2 enzymes act via selective protein-protein interactions with the E1 and E3 enzymes and connect activation to covalent modification. By doing so, E2s differentiate effects on downstream substrates, either with a single Ub/UBL molecule or as a chain. UBCH8 is highly similar in primary structure to the enzyme encoded by the UBE2L3 gene. It catalyzes the covalent attachment of ubiquitin or ISG15 to other proteins. UBCH8 functions in the E6/E6-AP-induced ubiquitination of p53/TP53 and promotes ubiquitination and subsequent proteasomal degradation of FLT3. At protein level, it is present in natural killer cells.

References

Moynihan TP, et al. (1999) The ubiquitin-conjugating enzymes UbcH7 and UbcH8 interact with RING finger/IBR motif-containing domains of HHARI and H7-AP1. J Biol Chem. 274(43):30963-8.

Ardley HC, et al. (2000) Genomic organization of the human ubiquitin-conjugating enzyme gene, UBE2L6 on chromosome 11q12. Cytogenet Cell Genet. 89(1-2):137-40.

Zhao C, et al. (2004) The UbcH8 ubiquitin E2 enzyme is also the E2 enzyme for ISG15, an IFN-alpha/beta-induced ubiquitin-like protein. Proc Natl Acad. 101(20):7578-82.

Tripathi MK, et al. (2005) Down-regulation of UCRP and UBE2L6 in BRCA2 knocked-down human breast cells. Biochem Biophys Res Commun. 328(1):43-8.

Catalog Number:FGI196-CF