Ferret PRMT6 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:FGG132-NM

Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1128bp
Gene Synonym
PRMT6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Ferret Mustela putorius furo (sub-species: furo) protein arginine methyltransferase 6 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein arginine N-methyltransferase 6, also known as Histone-arginine N-methyltransferase PRMT6, PRMT6, and HRMT1L6, is a member of the protein arginine N-methyltransferase family and PRMT6 subfamily. PRMT6 is highly expressed in kidney and testes. PRMT6 is known to catalyze the generation of asymmetric dimethylarginine in polypeptides. It has been implicated in human immunodeficiency virus pathogenesis, DNA repair, and transcriptional regulation. PRMT6 is known to methylate histone H3 Arg-2 (H3R2), and this negatively regulates the lysine methylation of H3K4 resulting in gene repression. PRMT6 plays a key role in coupling process by functioning as a transcriptional coactivator that can regulate alternative splicing. PRMT6 coactivates the progesterone, glucocorticoid and oestrogen receptors in luciferase reporter assays in a hormone-dependent manner. Small interfering RNA (siRNA) oligonucleotide duplex knockdown of PRMT6 disrupts oestrogen-stimulated transcription of endogenous GREB1 and progesterone receptor in MCF-7 breast cancer cells. Neutralizing the activity of PRMT6 could inhibit tumor progression and may be of cancer therapeutic significance.
References
  • Hyllus D, et al., 2007, Genes Dev. 21(24): 3369-80.
  • Lakowski, TM. et al., 2008, J Biol Chem. 283 (15): 10015-25. 
  • Michaud-Levesque, J. et al., 2009, J Biol Chem. 284 (32): 21338-46.
  • Harrison, MJ. et al., 2010, Nucleic acids Res. Jan 4.
  • TOP