Rat Cathepsin E/CTSE Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:FGB141-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1197bp
Gene Synonym
CEA, CEB, Ctsea
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cathepsin E Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cathepsin E Protein (CTSE Protein) is a member of the peptidase C1 family that is a gastric aspartic protease that functions as a disulfide-linked homodimer. Cathepsin E Protein (CTSE Protein) is predominantly present in the cells of immune system and is frequently implicated in antigen processing via the MHC classâ…ˇ pathway which however does not appear to be involved in the digestion of dietary protein. The protein has a specificity similar to that of pepsin and pepsin. Cathepsin E Protein (CTSE Protein) is found in highest concentration in the surface of epithelial mucus-producing cells of the stomach and also been found in more than half of the gastric cancers. It appears, therefore, to be an oncofetal antigen.
References
  • Zaidi N, et al. (2008) Emerging functional foles of cathepsin E. Biochem Biophys Res Commun. 377(2) : 327-30.
  • Zaidi N, et al. (2008) Cathepsin E: a mini review. Biochem Biophys Res Commun. 367(3) :517-22.
  • Azuma T, et al. (1989) Human gastric cathepsin E Predicted sequence, localization to chromosome 1, and sequence homology with other aspartic proteinases.The journal of biological chemistry. 264: 16748-53.
  • TOP