Ferret CAT/Catalase Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Ferret

NCBI Ref Seq

XM_004790325.1

RefSeq ORF Size

1584bp

Gene Synonym

CAT

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Ferret Mustela putorius furo (sub-species: furo) catalase Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a tetramer of four polypeptides chains containing four porphyrin heme groups that allow the enzyme to react with the hydrogen peroxide. The optimum PH of human catalase is approximately 7 and the optimum temperature is at 37 degree. Both the PH optimum and temperature for other catalases varies depending on the species. Catalase can be inhibited by a flux of O^2- generated in situ by the aerobic xanthine oxidase reaction. This inhibition of catalase by O^2- provides the basis for a synergism between superoxide dismutase and catalase.Such synergisms have been observed in vitro and may be significant in vivo. Catalase is used in the food industry for removing hydrogen peroxide from milk prior to cheese production. Another use is in food wrappers where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free.

References

Schriner SE. et al., 2005, Science. 308 (5730): 1909-11.

Kono Y. et al., 1982, The Journal of Biological Chemistry. 257: 5751-4.

Catalog Number:FGB136-CM