Rat C1 inhibitor/SerpinG1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

XM_006234447.1

RefSeq ORF Size

1515bp

Gene Synonym

Serping1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Plasma protease C1 inhibitor, also known as C1-inhibiting factor, C1-INH, C1 esterase inhibitor, SERPING1 and C1IN, is a serine proteinase inhibitor (serpin) that regulates activation of both the complement and contact systems. By its C-terminal part (serpin domain), characterized by three beta-sheets and an exposed mobile reactive loop, C1-INH binds, and blocks the activity of its target proteases. The N-terminal end (nonserpin domain) confers to C1-INH the capacity to bind lipopolysaccharides and E-selectin. Owing to this moiety, C1-INH intervenes in regulation of the inflammatory reaction. The heterozygous deficiency of C1-INH results in hereditary angioedema (HAE). Owing to its ability to modulate the contact and complement systems and the convincing safety profile, plasma-derived C1 inhibitor is an attractive therapeutic protein to treat inflammatory diseases other than HAE. Deficiency of C1 inhibitor results in hereditary angioedema, which is characterized by recurrent episodes of localized angioedema of the skin, gastrointestinal mucosa or upper respiratory mucosa. C1 inhibitor may prove useful in a variety of other diseases including septic shock, reperfusion injury, hyperacute transplant rejection, traumatic and hemorrhagic shock, and the increased vascular permeability associated with thermal injury, interleukin-2 therapy and cardiopulmonary bypass.

References

Davis AE 3rd. et al. (2004) Biological effects of C1 inhibitor. Drug News Perspect. 17(7): 439-46.

Cicardi M, et al. (2005) C1 inhibitor: molecular and clinical aspects. Springer Semin Immunopathol. 27(3): 286-98.

Wouters D, et al. (2008) C1 inhibitor: just a serine protease inhibitor? New and old considerations on therapeutic applications of C1 inhibitor. Expert Opin Biol Ther. 8(8): 1225-40.

Cugno M, et al. (2009) C1-inhibitor deficiency and angioedema: molecular mechanisms and clinical progress. Trends Mol Med. 15(2): 69-78.

Catalog Number:FGA914-NM