Rat Beta-2 microglobulin/B2M Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_012512.2

RefSeq ORF Size

360bp

Gene Synonym

B2m

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat beta-2 microglobulin Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

B2M, also known as β2-Microglobulin or CDABP0092, is a component of MHC class I molecules found expression in all nucleated cells (excludes red blood cells). The major function of MHC class I moleculesis is to display fragments of proteins from within the cell to T-cells and cells containing foreign proteins will be attacked. B2M(β2-Microglobulin) is a low molecular weight protein. It was demonstrated that B2M(β2-Microglobulin) was localized in the membranes of nucleated cells and was found to be associated with HL-A antigens.B2M(β2- Microglobulin) is present in free form in various body fluids and as a subunit of histocompatibility antigens on cell surfaces lateral to theα3 chain. Unlikeα3, β2 has no transmembrane region. Directly above β2 lies the α1 chain, which itself is lateral to the α2. In the absence of B2M(β2 microglobulin), very limited amounts of MHC class I (classical and non-classical) molecules can be detected on the surface. In the absence of MHC class I, CD8 T cells, a subset of T cells involved in the development of acquired immunity cannot develop. Low levels of B2M(β2 microglobulin) can indicate non-progression of HIV.

References

Poulik MD, et al. (1979) Beta 2-Microglobulin: methods and clinical applications. CRC Ctit Rev Clin Lab Sci. 10(3): 225-45.

Poulik MD, et al. (1975) Beta2-Microglobulins. Contemp Top Mol Immunol. 4: 157-204.

Berggard I. (1976) Beta2-Microglobulins: isolation, properties, and distribution. Fed Proc. 35(5): 1167-70.

Catalog Number:FGA798-CM