Rat TrkB/NTRK2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:DGI052-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1431bp
Gene Synonym
Tkrb, trkB, TRKB1, RATTRKB1, Ntrk2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat neurotrophic tyrosine kinase, receptor, type 2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptors with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, longterm potentiation and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.
References
  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
  • TOP