Rat TNFRSF19/TROY Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:DGH926-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1251bp
Gene Synonym
RGD1564996, Tnfrsf19
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 19 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), also known as TAJ-alpha or TROY, is a member of the TNF-receptor superfamily. TNFRSF19/TROY expression is detected in the pulmonary epithelium and the ductal epithelium of the prostate and parotid glands. TNFRSF19/TROY expression is detected in some adenocarcinoma cell lines that arise from this tissue. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. TNFRSF19/TROY is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. TNFRSF19/TROY was negatively regulated by adipogenic transcription factor CCAAT/enhancer-binding proteins (C/EBP). TNFRSF19 signals activation of the Jnk pathway and induces cell death. Overexpression of TNFRSF19 also signals NFB activation, comparable and similar to that by p75NGFR. TNFRSF19/TROY is capable of activating key signaling pathways of the TNF receptor family, and its predominant expression patterns suggest that it plays a role in the growth and regulation of epithelial tissues.
References
  • Hu S, et al. (1999) Characterization of TNFRSF19, a novel member of the tumor necrosis factor receptor superfamily. Genomics. 62(1): 103-7.
  • Qiu W, et al. (2010) Tumor necrosis factor receptor superfamily member 19 (TNFRSF19) regulates differentiation fate of human mesenchymal (stromal) stem cells through canonical Wnt signaling and C/EBP. J Biol Chem. 285(19): 14438-49.
  • Hisaoka T, et al. (2006) Characterization of TROY/TNFRSF19/TAJ-expressing cells in the adult mouse forebrain. Brain Res. 1110(1): 81-94.
  • TOP