Rat TIM-1/KIM-1/HACVR Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:DGH731-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
924bp
Gene Synonym
Kim1, KIM-1, Havcr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat hepatitis A virus cellular receptor 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
HAV cellular receptor 1 (HAVCR1), also known as Kidney injury molecule 1 (KIM-1) and T cell immunoglobulinmucin 1 (TIM-1), is a type â…  integral membrane glycoprotein. KIM-1 protein is widely expressed with highest levels in kidney and testis. It has been shown to play a major role as a human susceptibility gene for asthma, allergy and autoimmunity. IgA1lambda is a specific ligand of KIM-1 protein and that their association has a synergistic effect in virus-receptor interactions. KIM-1 involves in the pathogenesis of acute kidney injury. It had been confirmed that KIM-1 is a human urinary renal dysfunction biomarker. Moreover, KIM-1 protein is a novel regulatory molecule of flow-induced calcium signaling.
References
  • Tami C, et al. (2007) Immunoglobulin A (IgA) is a natural ligand of hepatitis A virus cellular receptor 1 (HAVCR1), and the association of IgA with HAVCR1 enhances virus-receptor interactions. J Virol. 81(7): 3437-46.
  • Rees AJ, et al. (2008) Kim-1/Tim-1: from biomarker to therapeutic target? Nephrol Dial Transplant. 23(11): 3394-6.
  • Chaturvedi S, et al. (2009) Assay validation for KIM-1: human urinary renal dysfunction biomarker. Int J Biol Sci. 5(2): 128-34.
  • TOP