Canine SPARCL1 / SPARC-like 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Canine

NCBI Ref Seq

XM_005639162.1

RefSeq ORF Size

2004bp

Gene Synonym

SPARCL1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine SPARC-like 1 (hevin) Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SPARC-like protein 1 (SPARCL1; also known as SC1, high endothelial venule protein, or hevin) is an extracellular matrix-associated, secreted glycoprotein belonging to the secreted protein acidic and rich in cysteine (SPARC) family of matricellular proteins. It contains three conserved structural domains that are implicated in the regulation of cell adhesion, migration, and proliferation. SPARCL1 is expressed during embryogenesis and tissue remodeling and is especially prominent in brain and vasculature. Its down-regulation in a number of cancers and the possibility of its functional compensation by SPARC has led to recent interest in hevin as a tumor suppressor and regulator of angiogenesis. SPARCL1 has antiadhesive properties, and loss of SPARCL1 expression is associated with increased proliferative activity and cell cycle progression. It is suggested that it may influence multiple cellular processes during distinct stages of brain development and function. In addition, SPARCL1 can influence the function of astroglial cells in the developing and mature central nervous system (CNS).

References

Sullivan MM, et al. (2004) Hevin/SC1, a matricellular glycoprotein and potential tumor-suppressor of the SPARC/BM-40/Osteonectin family. Int J Biochem Cell Biol. 36(6): 991-6.

Esposito I, et al. (2007) Tumor-suppressor function of SPARC-like protein 1/Hevin in pancreatic cancer. Neoplasia. 9(1): 8-17.

Weimer JM, et al. (2008) A BAC transgenic mouse model to analyze the function of astroglial SPARCL1 (SC1) in the central nervous system. Glia. 56(9): 935-41.

Catalog Number:DGH331-CO