Canine SNAP25 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:DGH262-CF

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
621bp
Gene Synonym
SNAP25
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Canine synaptosomal-associated protein, 25kDa Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Synaptosomal-associated protein 25, also known as Super protein, Synaptosomal-associated 25 kDa protein, SNAP25 and SNAP, is a cytoplasm and cell membrane protein which belongs to the SNAP-25 family. SNAP25 / SUP contains 2 t-SNARE coiled-coil homology domains. SNAP25 / SUP is a membrane bound protein anchored to the cytosolic face of membranes via palmitoyl side chains in the middle of the molecule. SNAP25 / SUP protein is a component of the SNARE complex, which is proposed to account for the specificity of membrane fusion and to directly execute fusion by forming a tight complex that brings the synaptic vesicle and plasma membranes together. SNAP25 / SUP is a Q-SNARE protein contributing two α-helices in the formation of the exocytotic fusion complex in neurons where it assembles with syntaxin-1 and synaptobrevin. SNAP25 / SUP is involved in the molecular regulation of neurotransmitter release. It may play an important role in the synaptic function of specific neuronal systems. SNAP25 / SUP associates with proteins involved in vesicle docking and membrane fusion. SNAP25 / SUP regulates plasma membrane recycling through its interaction with CENPF. SNAP25 / SUP inhibits P/Q- and L-type voltage-gated calcium channels located presynaptically and interacts with the synaptotagmin C2B domain in Ca2+-independent fashion. In glutamatergic synapses SNAP25 / SUP decreases the Ca2+ responsiveness, while it is naturally absent in GABAergic synapses.
References
  • Hodel A ,et al.,1998, Int. J. Biochem. Cell Biol. 30 (10): 1069-73.
  • Sudhof TC, et al.,2002, Nat Rev Neurosci 3 (8): 641-653.
  • Chapman ER et al.,2002, Nat. Rev. Mol. Cell Biol. 3(7): 498-508.
  • Chen X., et al., 2002, Neuron 33:397-409.
  • Huang Q., et al., 2008, FEBS Lett. 582:1431-1436.
  • TOP