Canine SDF-1/CXCL12 Gene ORF cDNA clone expression plasmid,C terminal His tag

Gene

Species

Canine

NCBI Ref Seq

NM_001128097.1

RefSeq ORF Size

282bp

Gene Synonym

SDF1, CXCL12

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine chemokine (C-X-C motif) ligand 12 Gene ORF cDNA clone expression plasmid,C terminal His tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-His

Restriction Site

Protein Tag

His

Tag Sequence

CACCATCACCACCATCATCACCACCATCAC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The human stromal cell-derived factor-1 (SDF1), also known as CXCL12, is a small (8 kDa) cytokine highly conserved chemotactic cytokine belonging to the large family of CXC chemokines. SDF1 is expressed in two isoforms from a single gene that encodes two splice variants, SDF1α and SDF1β, which are identical except for the four residues present in the C-terminus of SDF1β but absent from SDF1α. The chemokine CXCL12 [stromal cell-derived factor-1 (SDF-1)] binds primarily to CXC receptor 4 (CXCR4; CD184). The binding of CXCL12 to CXCR4 induces intracellular signaling through several divergent pathways initiating signals related to chemotaxis, cell survival and/or proliferation, increase in intracellular calcium, and gene transcription. CXCL12 and CXCR4 that have been widely characterized in peripheral tissues and delineate their main functions in the CNS. Extensive evidence supports CXCL12 as a key regulator for early development of the CNS. In the mature CNS, CXCL12 modulates neurotransmission, neurotoxicity and neuroglial interactions. CXCL12 has crucial roles in the formation of multiple organ systems during embryogenesis and in the regulation of bone marrow haematopoiesis and immune function in the postnatal organism. Although considered an important factor in normal bone metabolism, recent studies implicate CXCL12 in the pathogenesis of several diseases involving the skeleton, including rheumatoid arthritis and cancers that metastasize to bone. The CXCL12/CXCR4 axis is involved in tumor progression, angiogenesis, metastasis, and survival. Pathologically enhanced CXCL12 signaling may promote the formation of new vessels through recruiting circulating endothelial progenitor cells or directly enhancing the migration/growth of endothelial cells. Therefore, CXCL12 signaling represents an important mechanism that regulates brain tumor angiogenesis/vasculogenesis and may provide potential targets for anti-angiogenic therapy in malignant gliomas.

References

Bleul, C.C. et al., 1996, Nature. 382: 829-833.

Sapede, D. et al., 2005, Proc. Natl. Acad. Sci. USA. 102: 1714-1718.

Delgado, M.B. et al., 2001, Eur. J. Immunol. 31: 699-707.

Orimo, A. et al., 2005, Cell. 121: 335-348.

Kryczek, I. et al., 2007, Am. J. Physiol. Cell. Physiol. 292: C987-995.

Bbalabanian, K. et al., 2005, J. Biol. Chem. 280: 35760-35766.

Catalog Number:DGG874-CH