Canine IL3RA/CD123 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Canine

NCBI Ref Seq

XM_846533.3

RefSeq ORF Size

1128bp

Gene Synonym

IL3RA

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine interleukin 3 receptor, alpha (low affinity) Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-3 receptor subunit alpha, also known as IL-3 receptor subunit alpha, IL-3R-alpha, CD123, and IL3RA, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 5 subfamily. The specific alpha subunit of the interleukin-3 receptor (IL-3Ralpha, CD123) is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. The WSXWS motif of IL3RA appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box one motif of IL3RA is required for JAK interaction and / or activation. IL3RA represents a unique marker for primitive leukemic stem cells. Targeting of IL3RA may be a promising strategy for the preferential ablation of AML cells. Aberrant IL3RA expression is a good marker for monitoring of minimal residual disease. IL3RA is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. Recent studies have shown that interleukin-3 receptor alpha (CD123) is highly expressed on leukemia stem cells of patients with acute myeloid leukemia, and is correlated with tumor load and poor prognosis. CD123 was highly expressed in the bone marrow of the patients with myelodysplastic syndrome (MDS), significantly correlated with the proportion of bone marrow blasts, and thus might be the marker of MDS malignant clone. IL3RA is also a useful new marker for distinguishing B-cell disorders with circulating villous lymphocytes as its expression is characteristic of typical hairy cell leukemia (HCL) with high sensitivity and specificity.

References

Del Giudice I, et al. (2004) The diagnostic value of CD123 in B-cell disorders with hairy or villous lymphocytes. Haematologica. 89(3): 303-8.

Du X, et al. (2007) New immunotoxins targeting CD123, a stem cell antigen on acute myeloid leukemia cells. J Immunother. 30(6): 607-13.

Yue LZ, et al. (2010) Expression of CD123 and CD114 on the bone marrow cells of patients with myelodysplastic syndrome. Chin Med J (Engl). 123(15): 2034-2037.

Catalog Number:DGD954-NO