Canine IL-8/Interleukin-8/CXCL8 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:DGD905-CO

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
306bp
Gene Synonym
IL8
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Canine interleukin 8 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 8 (IL-8), also known as CXCL8, which is a chemokine with a defining CXC amino acid motif that was initially characterized for its leukocyte chemotactic activity, is now known to possess tumorigenic and proangiogenic properties as well. This chemokine is secreted by a variety of cell types including monocyte/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli (IL1, TNF, LPS, etc). In human gliomas, IL-8 is expressed and secreted at high levels both in vitro and in vivo, and recent experiments suggest it is critical to glial tumor neovascularity and progression. Levels of IL-8 correlate with histologic grade in glial neoplasms, and the most malignant form, glioblastoma, shows the highest expression in pseudopalisading cells around necrosis, suggesting that hypoxia/anoxia may stimulate expression. Interleukin (IL)-8/CXCL8 is a potent neutrophil chemotactic factor. Accumulating evidence has demonstrated that various types of cells can produce a large amount of IL-8/CXCL8 in response to a wide variety of stimuli, including proinflammatory cytokines, microbes and their products, and environmental changes such as hypoxia, reperfusion, and hyperoxia. Numerous observations have established IL-8/CXCL8 as a key mediator in neutrophil-mediated acute inflammation due to its potent actions on neutrophils. However, several lines of evidence indicate that IL-8/CXCL8 has a wide range of actions on various types of cells, including lymphocytes, monocytes, endothelial cells, and fibroblasts, besides neutrophils. The discovery of these biological functions suggests that IL-8/CXCL8 has crucial roles in various pathological conditions such as chronic inflammation and cancer. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression.
References
  • Mukaida N. (2003) Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. Am J Physiol Lung Cell Mol Physiol. 284(4): L566-77.
  • Brat DJ, et al. (2005) The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 7(2): 122-33.
  • Bendrik C, et al. (2009) Estradiol increases IL-8 secretion of normal human breast tissue and breast cancer in vivo. J Immunol. 182(1): 371-8.
  • TOP