Rat IGF1/IGF‑I/IGF-1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001082479.1

RefSeq ORF Size

462bp

Gene Synonym

Igf1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat insulin-like growth factor 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IGF I, also known as mechano growth factor, somatomedin-C, IGF-I and IGF1, is a secreted protein which belongs to the?insulin family. The insulin family, comprised of insulin, relaxin, insulin-like growth factors I and II ( IGF-I and IGF-II ) and possibly the beta-subunit of 7S nerve growth factor, represents a group of structurally related polypeptides whose biological functions have diverged. The IGFs, or somatomedins, constitute a class of polypeptides that have a key role in pre-adolescent mammalian growth. IGF-I expression is regulated by GH and mediates postnatal growth, while IGF-II appears to be induced by placental lactogen during prenatal development. IGF1 / IGF-I may be a physiological regulator of [1-14C]-2-deoxy-D-glucose (2DG) transport and glycogen synthesis in osteoblasts. IGF1 / IGF-I stimulates glucose transport in rat bone-derived osteoblastic (PyMS) cells and is effective at much lower concentrations than insulin, not only regarding glycogen and DNA synthesis but also with regard to enhancing glucose uptake. Defects in IGF1 / IGF-I are the cause of insulin-like growth factor I deficiency (IGF1 deficiency) which is an autosomal recessive disorder characterized by growth retardation, sensorineural deafness and mental retardation.

References

Catalog Number:DGD835-CF