Rat GFRA1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:DGD086-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1407bp
Gene Synonym
Gfra1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat GDNF family receptor alpha 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 1 (GFRA1) is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA1 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. GDNF, a distantly related member of the transforming growth factor-β (TGF-â) superfamily, and its receptor components: GFRA1, Ret and neural cell adhesion molecule (NCAM) have been recently reported to be expressed in the testis and to be involved in the proliferation regulation of immature Sertoli cells.
References
  • Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.
  • Jing S, et al. (1996) GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell. 85(7):1113-24.
  • Treanor JJ, et al. (1996) Characterization of a multicomponent receptor for GDNF. Nature. 382(6586): 80-3.
  • TOP