Rat FGF9 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:DGC816-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
627bp
Gene Synonym
Fgf9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat fibroblast growth factor 9 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fibroblast growth factor 9 (FGF9) also known as Glia-activating factor or Heparin-binding growth factor 9, is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis. FGF9 plays an important role in the regulation of embryonic development, cell proliferation, cell differentiation and cell migration. FGF9 may have a role in glial cell growth and differentiation during development, gliosis during repair and regeneration of brain tissue after damage, differentiation and survival of neuronal cells, and growth stimulation of glial tumors.
References
  • Giri D, et al. (1999) FGF9 is an autocrine and paracrine prostatic growth factor expressed by prostatic stromal cells. J Cell Physiol. 180(1): 53-60.
  • Schmahl J, et al. (2004) Fgf9 induces proliferation and nuclear localization of FGFR2 in Sertoli precursors during male sex determination. Development. 131(15): 3627-36.
  • Garcès A, et al. (2000) FGF9: a motoneuron survival factor expressed by medial thoracic and sacral motoneurons. J Neurosci Res. 60(1): 1-9.
  • TOP