Canine FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Canine

NCBI Ref Seq

XM_003434129.1

RefSeq ORF Size

591 bp

Gene Synonym

FGF12

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine fibroblast growth factor 12 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

HindIII + XbaI(6kb+0.59kb)

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

References

Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.

Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.

Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.

Catalog Number:DGC794-NM