Canine CCL26/Eotaxin-3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:DGB222-CY

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
285bp
Gene Synonym
CCL26
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Canine chemokine (C-C motif) ligand 26 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The eotaxin subfamily of CC chemokines consists of eotaxin-1/CCL11, eotaxin-2/CCL24 and eotaxin-3/CCL26. All eotaxins induce the trafficking of eosinophils to the sites of inflammation via CC chemokine receptor 3 (CCR3), which is also expressed by several different cell types, including basophils, dendritic cells, smooth muscle cells, epithelial cells and fibroblasts. The sequence similarity between the three eotaxins is limited (<40%), but their functional properties are very similar. Eotaxin-1 and -2 are expressed by both haematopoietic and non-haematopoietic cells, but eotaxin-3 expression has been reported to be limited to non-haematopoietic cells. Interleukin (IL)-4 is the main inducer for eotaxin-3 expression, whereas eotaxin-1 is up-regulated by IL-4 and the proinflammatory cytokine tumour necrosis factor (TNF)-α. Eotaxin-3 is expressed in vascular endothelial cells and human dermal fibroblasts after IL-4 and IL-13 stimulation, and this is dependent upon the IL-4-/IL-13-specific transcription factor, signal transducers and activator of transcription (STAT)-6. Eotaxin-3 is expressed on the surface of IL-4-stimulated endothelial cells and promotes eosinophil transmigration.
References
  • Takahashi K, Imaeda H, Fujimoto T, et al. Regulation of eotaxin-3/CC chemokine ligand 26 expression by T helper type 2 cytokines in human colonic myofibroblasts. Clinical and Experimental Immunology. 2013;173(2):323-331.
  • TOP