Rhesus WSX-1/IL-27R Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001111176.2

RefSeq ORF Size

1911bp

Gene Synonym

IL27RA

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus interleukin 27 receptor, alpha Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The interleukin-27 receptor is a type I cytokine receptor for interleukin-27. It is a heterodimer composed of the interleukin 27 receptor, alpha subunit and glycoprotein 130. WSX-1/IL-27R, a class I cytokine receptor that is homologous to the β2 chain of the IL-12R in both sequence and structure, is highly expressed by resting/naive CD4+ T cells and CD8+ T cells. WSX-1/IL-27R belongs to the IL-6/IL-12 family of cytokines and induced proliferation of naive CD4(+) T cells and the generation of a Th1-type adaptive immune response. WSX-1/IL-27R functions as a receptor for IL27. IL-27 not only contributes to the development of an adaptive immune response through its action on CD4(+) T cells, it also directly acts on cells of the innate immune system. WSX-1/IL-27R requires IL6ST/gp130 to mediate signal transduction in response to IL27. This signaling system acts through STAT3 and STAT1. It is involved in the regulation of Th1-type immune responses. IL-27R also appears to be involved in innate defense mechanisms. IL27RA is essential for transcriptional activation of STAT1 and for augmenting the induction of T-bet expression during initiation of Th1 cell differentiation.

References

Pflanz S, et al.. (2004) WSX-1 and glycoprotein 130 constitute a signal-transducing receptor for IL-27. J Immunol. 172(4): 2225-31.

Yoshida H, et al.. (2001) WSX-1 is required for the initiation of Th1 responses and resistance to L. major infection. Immunity. 215(4): 569-78.

Villarino A, et al.. (2003) The IL-27R (WSX-1) is required to suppress T cell hyperactivity during infection. Immunity. 19(5): 645-55.

Catalog Number:CGI469-NY