Cynomolgus UBE1 / UBA1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Cynomolgus

NCBI Ref Seq

XM_005593407.1

RefSeq ORF Size

3177bp

Gene Synonym

UBA1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Cynomolgus ubiquitin-like modifier activating enzyme 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

References

Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.

Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.

Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.

Catalog Number:CGI197-CM