Rat TPST1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001011903.2

RefSeq ORF Size

1113bp

Gene Synonym

Tpst1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tyrosylprotein sulfotransferase 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Protein-tyrosine sulfotransferase 1, also known as Tyrosylprotein sulfotransferase 1 and TPST1, is a single-pass type I I membrane protein which belongs to the protein sulfotransferase family. Tyrosine O-sulfation is a common posttranslational modification of proteins in all multicellular organisms. This reaction is mediated by a Golgi enzyme activity called tyrosylprotein sulfotransferase (TPST) that catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to tyrosine residues within acidic motifs of polypeptides. Tyrosine O-sulfation has been shown to be important in protein-protein interactions in several systems. Tyrosine sulfation is mediated by one of two Golgi isoenzymes, called tyrosylprotein sulfotransferases (TPST-1 and TPST-2). A relatively small number of proteins are known to undergo tyrosine sulfation, including certain adhesion molecules, G-protein-coupled receptors, coagulation factors, serpins, extracellular matrix proteins, and hormones. TPST1 is a human tyrosylprotein sulfotransferase that uses 3'phosphoadenosine-5'phosphosulfate (PAPS) to transfer the sulfate moiety to proteins predominantly designated for secretion. TPST1 bears N-linked glycosyl residues exclusively at position Asn60 and Asn262. TPST1 and TPST2 have distinct biological roles that may reflect differences in their macromolecular substrate specificity.

References

Ouyang Y.-B.et al., 1998, Proc. Natl. Acad. Sci. USA. 95: 2896-901.

Ouyang,Y.B. et al., 2002,J Biol Chem. 277 (26):23781-7.

Hoffhines, A.J. et al., 2006, J Biol Chem. 281 (49):37877-87.

Goettsch,S. et al., 2006, J Mol Biol. 361 (3):436-49.

Westmuckett, A.D. et al., 2008, Gen Comp Endocrinol. 156 (1):145-53.

Catalog Number:CGH988-NY