Rat Thrombomodulin / THBD Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:CGH712-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1734bp
Gene Synonym
Thbd
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat thrombomodulin Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Thrombomodulin, also known as THBD(CD141), is an integral membrane protein which reduces blood coagulation by converting thrombin to an anticoagulant enzyme from a procoagulant enzyme. Thrombomodulin is expressed on the surface of endothelial cells and serves as a cofactor for thrombin. It is also expressed on human mesothelial cell, monocyte and a dendritic cell subset. Thrombomodulin functions as a cofactor in the thrombin-induced activation of protein C in the anticoagulant pathway by forming a 1:1 stoichiometric complex with thrombin. Thrombomodulin also regulates C3b inactivation by factor I. Mutations in the thrombomodulin gene have also been reported to be associated with atypical hemolytic-uremic syndrome.
References
  • Dzionek A, et al. (2002) Plasmacytoid dendritic cells: from specific surface markers to specific cellular functions. Hum Immunol. 63(12):1133-48.
  • Dzionek A, et al. (2000) BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol. 165(11):6037-46.
  • Wen DZ, et al. (1987) Human thrombomodulin: complete cDNA sequence and chromosome localization of the gene. Biochemistry. 26(14):4350-7.
  • TOP