Rat RANKL/OPGL/TNFSF11/CD254 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:CGG404-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
957bp
Gene Synonym
RANKL, Tnfsf11, Opgl, Trance
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 11 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tumor necrosis factor ligand superfamily member 11, also known as Receptor activator of nuclear factor kappa-B ligand, Osteoprotegerin ligand, TNFSF11, RANKL, TRANCE, OPGL and CD254, is a single-pass type II membrane protein which belongs to the tumor necrosis factor family. The receptor activator of nuclear factor-kappaB ligand (RANKL), its cognate receptor RANK, and its natural decoy receptor osteoprotegerin have been identified as the final effector molecules of osteoclastic bone resorption. RANK and RANKL are key regulators of bone remodeling and regulate T cell/dendritic cell communications, and lymph node formation. Moreover, RANKL and RANK are expressed in mammary gland epithelial cells and control the development of a lactating mammary gland during pregnancy. Genetically, RANKL and RANK are essential for the development and activation of osteoclasts and bone loss in response to virtually all triggers tested. Inhibition of RANKL function via the natural decoy receptor osteoprotegerin (OPG, TNFRSF11B) prevents bone loss in postmenopausal osteoporosis and cancer metastases. Importantly, RANKL appears to be the pathogenetic principle that causes bone and cartilage destruction in arthritis. RANK-RANKL signaling not only activates a variety of downstream signaling pathways required for osteoclast development, but crosstalk with other signaling pathways also fine-tunes bone homeostasis both in normal physiology and disease. In addition, RANKL and RANK have essential roles in lymph node formation, establishment of the thymic microenvironment, and development of a lactating mammary gland during pregnancy.
References
  • Takayanagi H, et al. (2002) Signaling crosstalk between RANKL and interferons in osteoclast differentiation. Arthritis Res. 4 Suppl 3: S227-32.
  • Nakashima T, et al. (2003) RANKL and RANK as novel therapeutic targets for arthritis. Curr Opin Rheumatol. 15(3): 280-7.
  • Schwarz EM, et al. (2007) Clinical development of anti-RANKL therapy. Arthritis Res Ther. 9 Suppl 1: S7.
  • Leibbrandt A, et al. (2008) RANK/RANKL: regulators of immune responses and bone physiology. Ann N Y Acad Sci. 1143: 123-50.
  • TOP