Rhesus PCNA Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001266090.1

RefSeq ORF Size

786bp

Gene Synonym

PCNA

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus proliferating cell nuclear antigen Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Proliferating Cell Nuclear Antigen (PCNA) is a protein only expresse in nomal proliferate cells and cancer cells. It is central to both DNA replication and repair. One of the well-established functions for PCNA is its role as the processivity factor for DNA polymerase delta and epsilon. PCNA tethers the polymerase catalytic unit to the DNA template for rapid and processive DNA synthesis. Two forms of PCNA exist in cells: (i) a detergent-insoluble trimeric form stably associated with the replicating forks during S phase and (ii) a soluble form in quiescent cells in G1 and G2 phases. PCNA forms a toroidal trimer in S phase with replication factor-C (RF-C) and DNA in an ATP-dependent manner and enables the loading of DNA polymerase delta and epsilon onto the complex. The close association of PCNA with kinase complexes involved in cell cycle machinery indicates that PCNA has a regulatory role in cell cycle progression. PCNA also participates in the processing of branched intermediates that arise during the lagging strand DNA synthesis.

References

Balajee AS, et al. (2001) Chromatin-bound PCNA complex formation triggered by DNA damage occurs independent of the ATM gene product in human cells. Nucleic Acids Res. 29 (6): 1341-51.

Ducoux M, et al. (2001) Mediation of proliferating cell nuclear antigen (PCNA)-dependent DNA replication through a conserved p21(Cip1)-like PCNA-binding motif present in the third subunit of human DNA polymerase delta. J Biol Chem. 276 (52): 49258-66.

Tetsuo I, et al. (2002) PCNA clamp facilitates action of DNA cytosine methyltransferase 1 on hemimethylated DNA. Genes Cells. 7(10): 997-1007.

Catalog Number:CGF671-NO