Rhesus OMGP Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:CGF485-NM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1323bp
Gene Synonym
OMG
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus oligodendrocyte myelin glycoprotein Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Oligodendrocyte-myelin glycoprotein, also known as OMG and OMGP, is a cell membrane protein which contains eight LRR (leucine-rich) repeats. OMG / OMGP is a glycosylphosphatidylinositol-anchored protein expressed by neurons and oligodendrocytes in the central nervous system (CNS). OMG / OMGP is a cell adhesion molecule contributing to the interactive process required for myelination in the central nervous system. OMG / OMGP play roles in both the developing and adult central nervous system. OMG / OMGP participats in growth cone collapse and inhibition of neurite outgrowth through its interaction with NgR, the receptor for Nogo. This function requires its leucine-rich repeat domain, a highly conserved region in OMgp during mammal evolution. OMG / OMGP leucine-rich repeat domain is also implicated in the inhibition of cell proliferation. OMG / OMGP may also be involved in the formation and maintenance of myelin sheaths. Cell proliferation, neuronal sprouting and myelination are crucial processes involved in brain development and regeneration after injury.
References
TOP