Rat NAP-2 / PPBP / CXCL7 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:CGF132-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
336bp
Gene Synonym
Cxcl7, Nap-2, Ppbp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Pro-platelet basic protein (PPBP) is also known as Chemokine (C-X-C motif) ligand 7 (CXCL7) and nucleosome assembly protein (Nap-2). Nap-2 / PPBP / CXCL7 is released in large amounts from platelets following their activation and is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. Nap-2 / PPBP / CXCL7 has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. Nap-2 is a ligand for CXCR1 and CXCR2, and Nap-2, Nap-2 (73), Nap-2 (74), Nap-2 (1-66), and most potent Nap-2 (1-63) are chemoattractants and activators for neutrophils.
References
  • Walz A, et al. (1989) Effects of the neutrophil-activating peptide NAP-2, platelet basic protein, connective tissue-activating peptide III and platelet factor 4 on human neutrophils. J Exp Med. 170(5):1745-50.
  • Walz A, et al. (1990) Generation of the neutrophil-activating peptide NAP-2 from platelet basic protein or connective tissue-activating peptide III through monocyte proteases. J Exp Med. 171(2): 449-54.
  • Loetscher P, et al. (1994) Both interleukin-8 receptors independently mediate chemotaxis. Jurkat cells transfected with IL-8R1 or IL-8R2 migrate in response to IL-8, GRO alpha and NAP-2. FEBS Lett. 341(2-3): 187-92.
  • TOP