Rat LIFR/CD118 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:CGE359-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3282bp
Gene Synonym
Lifr
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat leukemia inhibitory factor receptor alpha Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
LIFR (leukemia inhibitory factor receptor) belongs to the family of cytokine receptors. LIFR forms a high-affinity receptor complex with gp130, which mediates the activity of LIF (leukemia inhibitory factor) and thus affects the differentiation, proliferation, and survival of a wide variety of cells in the adult and the embryo. Besides LIF, LIFR can also bind to and activate CNTF (ciliary neurotrophic factor) and CLC (cardiotrophin like cytokine). Evidence showed that in the retina, LIFR activating LIF, CT-1 and cardiotrophin like cytokine (CLC) are strongly upregulated in response to preconditioning with bright cyclic light leading to robust activation of signal transducer and activator of transcription-3 (STAT3) in a time-dependent manner. Further, blocking LIFR activation during preconditioning using a LIFR antagonist (LIF05) attenuated the induced STAT3 activation and also resulted in reduced preconditioning-induced protection of the retinal photoreceptors. These data demonstrate that LIFR and its ligands play an essential role in endogenous neuroprotective mechanisms triggered by preconditioning-induced stress. LIFR was newly found to be a suppressor of hepatocellular carcinoma (HCC), one of the world's top five causes of cancer-related deaths.
References
  • Gearing, D.P. et al.,1991, EMBO J. 10 (10): 2839-2848.
  • Gearing, D.P. et al.,1992, New Biol. 4 (1): 61-65.
  • Mosley, B. et al.,1996, J. Biol. Chem. 271 (51): 32635-32643.
  • Timmermann, A. et al.,2002, Eur. J. Biochem. 269 (11): 2716-2726.
  • Lass, A. et al.,2002, Fertil. Steril. 76 (6): 1091-1096.
  • TOP