Rhesus Interferon alpha-B / IFNA8 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:CGE011-NM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
570bp
Gene Synonym
IFNA8
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus interferon, alpha 8 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interferon alpha-B, also known as IFNA8, belongs to the alpha/beta interferon family. Interferons are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumorcells. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They also allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. Interferons also activate immune cells, such as natural killer cells and macrophages. They increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes. They also increase the ability of uninfected host cells to resist new infection by virus. Certain symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Produced by macrophages, IFN-alpha have antiviral activities.
References
  • Henco K. et al., 1985, J Mol Biol. 185 (2): 227-60.
  • Goeddel DV. et al., 1981, Nature. 290 (5801): 20-6.
  • Yelverton E. et al., 1981, Nucleic Acids Res. 9 (3): 731-41.
  • Kempaiah P. et al., 2012, Hum Genet. 131 (8): 1375-91.
  • TOP