Rat IL23R / IL23 Receptor Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

XM_002726387.1

RefSeq ORF Size

1920bp

Gene Synonym

Il23r

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 23 receptor Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IL23R, also known as IL23 receptor, belongs to the type I cytokine receptor family, Type 2 subfamily. It contains 2 fibronectin type-III domains and is expressed by monocytes, Th1, Th0, NK and dendritic cells. Isoform 1 is specifically expressed in NK cells. IL23R associates with IL12RB1 to form the interleukin-23 receptor. It binds IL23 and mediates T-cells, NK cells and possibly certain macrophage/myeloid cells stimulation probably through activation of the Jak-Stat signaling cascade. IL23 functions in innate and adaptive immunity and may participate in acute response to infection in peripheral tissues. IL23 may be responsible for autoimmune inflammatory diseases and be important for tumorigenesis. Genetic variations in IL23R are associated with inflammatory bowel disease type 17 (IBD17). IBD17 is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. Genetic variations in IL23R also can cause susceptibility to psoriasis type 7.

References

Duerr RH, et al. (2006) A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science. 314(5804):1461-3.

Cargill M, et al. (2007) A large-scale genetic association study confirms IL12B and leads to the identification of IL23R as psoriasis-risk genes. Am J Hum Genet. 80(2):273-90.

Dubinsky MC, et al. (2007) IL-23 receptor (IL-23R) gene protects against pediatric Crohn's disease. Inflamm Bowel Dis. 13(5):511-5.

Tremelling M, et al. (2007) IL23R variation determines susceptibility but not disease phenotype in inflammatory bowel disease. Gastroenterology. 132(5):1657-64.

Catalog Number:CGD949-NO