Rat IL1A/IL-1A/IL-1F1 Gene ORF cDNA clone expression plasmid,without any tag

Catalog Number:CGD936-UT

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
813bp
Gene Synonym
IL-1alpha, Il1a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 1 alpha Gene ORF cDNA clone expression plasmid,without any tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-untagged
Restriction Site
Protein Tag
Tag Sequence
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
IL-1 alpha is a member of the interleukin 1 cytokine family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. Cytokines can be classified into two groups: pro- and anti-inflammatory. Pro-inflammatory cytokines, including IFNgamma, IL-1, IL-6 and TNF-alpha, are predominantly derived from the innate immune cells and Th1 cells. Anti-inflammatory cytokines, including IL-10, IL-4, IL-13 and IL-5, are synthesized from Th2 immune cells. IL-1 alpha is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. It is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. IL-1 alpha stimulates thymocyte proliferation by inducing IL-2 release, B-cell maturation and proliferation, and fibroblast growth factor activity.
References
  • Nicklin MJ,et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19(2):382-4.
  • March CJ, et al. (1985) Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature. 315(6021):641-7.
  • Bankers-Fulbright JL, et al. (1996) Interleukin-1 signal transduction. Life Sci. 59(2):61-83.
  • Dinarello CA, et al. (1997) Induction of interleukin-1 and interleukin-1 receptor antagonist. Semin Oncol. 24 (3 Suppl 9):S9-81-S9-93.
  • TOP