Rhesus IL18RAP Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:CGD934-NM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1797bp
Gene Synonym
IL18RAP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus interleukin 18 receptor accessory protein Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 18 receptor accessory protein, also known as IL18RAP and CDw218b (cluster of differentiation w218b), is an accessory subunit of the heterodimeric receptor for IL18. This protein enhances the IL18 binding activity of IL18R1 (IL1RRP), a ligand binding subunit of IL18 receptor. The coexpression of IL18R1 and this protein is required for the activation of NF-kappaB and MAPK8 (JNK) in response to IL18. IL18RAP is required for the high affinity binding of interleukin 18 (IL-18) to its receptor complex. IL18RAP together with IL18R1 mediates IL-18-dependent activation of NF-kappa-B and JNK. Two putative isoforms of IL18RAP were detected and the ratios and total levels of these isoforms may contribute to the aetiology of coeliac disease. IL18R1 and IL18RAP polymorphisms have been found associated with diseases such as schizophrenia, HSV1 seropositivity and atopic asthma. Analysis of IL18R1 and IL18RAP SNPs in 5 European prospective cohorts suggests that the variability of these genes are unlikely to contribute to modulate the risk of CVD in European populations.
References
  • Zhernakova A, et al.. (2008) Genetic analysis of innate immunity in Crohn's disease and ulcerative colitis identifies two susceptibility loci harboring CARD9 and IL18RAP. Am J Hum Genet. 82(5): 1202-10.
  • Grisoni ML, et al.. (2009) Lack of association between polymorphisms of the IL18R1 and IL18RAP genes and cardiovascular risk: the MORGAM Project. BMC Med Genet. 10: 44.
  • Koskinen LL, et al.. (2009) Association study of the IL18RAP locus in three European populations with coeliac disease. Hum Mol Genet. 18(6): 1148-55.
  • TOP