Rhesus IGFBP3/IGFBP-3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001085359.2

RefSeq ORF Size

876bp

Gene Synonym

IGFBP3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus insulin-like growth factor binding protein 3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The Insulin-like Growth Factor (IGF) signaling system plays a central role in cellular growth, differentiation and proliferation. IGFBP3 is the most abundant IGF binding protein in human serum and has been shown to be a growth inhibitory, apoptosis-inducing molecule, capable of acting via IGF-dependent and IGF-independent mechanisms. It appears to function both by cell cycle blockade and the induction of apoptosis. IGFBP3 can be transported to the nucleus by an importin beta mediated mechanism, where it has been shown to interact with the retinoid X receptor alpha and possibly other nuclear elements. IGFBP3 antiproliferative signalling appears to require an active transforming growth factor beta (TGF-beta) signalling pathway, and IGFBP3 stimulates phosphorylation of the TGF-beta signalling intermediates Smad2 and Smad3. IGFBP3 has IGF-independent roles in inhibiting cell proliferation in cancer cell lines. Nuclear transcription factor, retinoid X receptor (RXR)-alpha, and IGFBP3 functionally interact to reduce prostate tumor growth and prostate-specific antigen in vivo. Several clinical studies have proposed that individuals with IGFBP3 levels in the upper range of normal may have a decreased risk for certain common cancers. This includes evidence of a protective effect against breast cancer, prostate cancer, colorectal cancer, and lung cancer. Moreover, IGFBP3 inhibits insulin-stimulated glucose uptake into adipocytes independent of IGF.

References

Baxter RC. (2001) Signalling pathways involved in antiproliferative effects of IGFBP-3: a review. Mol Pathol. 54(3): 145-8.

Butt AJ, et al. (2001) IGFBP-3 and apoptosis--a license to kill? Apoptosis. 6(3): 199-205.

Ali O, et al. (2003) Epidemiology and biology of insulin-like growth factor binding protein-3 (IGFBP-3) as an anti-cancer molecule. Horm Metab Res. 35(11-12): 726-33.

Yamada PM, et al. (2009) Perspectives in mammalian IGFBP-3 biology: local vs. systemic action. Am J Physiol Cell Physiol. 296(5): C954-76.

Catalog Number:CGD842-NF