Rhesus IGFBP1/IGFBP-1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001085935.2

RefSeq ORF Size

846bp

Gene Synonym

IGFBP1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus insulin-like growth factor binding protein 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IGFBP1, also known as IGFBP-1 and insulin-like growth factor-binding protein 1, is a member of the insulin-like growth factor binding protein family. IGF binding proteins (IGFBPs) are proteins of 24 to 45 kDa. All six IGFBPs share 50% homology with each other and have binding affinities for IGF-I and IGF-II at the same order of magnitude as the ligands have for the IGF-IR. IGF-binding proteins prolong the half-life of the IGFs and have been shown to either inhibit or stimulate the growth promoting effects of the IGFs on cell culture. They alter the interaction of IGFs with their cell surface receptors. IGFBP1 has an IGFBP domain and a thyroglobulin type-I domain. It binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors.

References

Wood AW, et al. (2005) Insulin-like growth factor signaling in fish. Int Rev Cytol. 243:215-85.

Firth SM, et al. (2003) Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev. 23 (6):824-54.

Ferry RJ, et al. (1999) Insulin-like growth factor binding proteins: new proteins, new functions. Horm Res. 51(2):53-67.

Catalog Number:CGD841-CY