Canine IGF1R/CD221/IGF-I R Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Canine

NCBI Ref Seq

XM_545828.3

RefSeq ORF Size

4104bp

Gene Synonym

IGF1R

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine insulin-like growth factor 1 receptor Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The insulin-like growth factor-1 receptor (IGF1R) is a transmembrane tyrosine kinase involved in several biological processes including cell proliferation, differentiation, DNA repair, and cell survival. This a disulfide-linked heterotetrameric transmembrane protein consisting of two α and two β subunits, and among which, the α subunit is extracellular while the β subunit has an extracellular domain, a transmembrane domain and a cytoplasmic tyrosine kinase domain. IGF1R signalling pathway is activated in the mammalian nervous system from early developmental stages. Its major effect on developing neural cells is to promote their growth and survival. This pathway can integrate its action with signalling pathways of growth and morphogenetic factors that induce cell fate specification and selective expansion of specified neural cell subsets. Modulation of cell migration is another possible role that IGF1R activation may play in neurogenesis. In the mature brain, IGF-I binding sites have been found in different regions of the brain, and multiple reports confirmed a strong neuroprotective action of the IGF-IR against different pro-apoptotic insults. IGF1R is an important signaling molecule in cancer cells and plays an essential role in the establishment and maintenance of the transformed phenotype. Inhibition of IGF1R signaling thus appears to be a promising strategy to interfere with the growth and survival of cancer cells. IGF1R is frequently overexpressed by tumours, and mediates proliferation and apoptosis protection. IGF signalling also influences hypoxia signalling, protease secretion, tumour cell motility and adhesion, and thus can affect the propensity for invasion and metastasis. Therefore, the IGF1R is now an attractive anti-cancer treatment target.

References

Bhr C, et al. (2004) The insulin like growth factor-1 receptor (IGF-1R) as a drug target: novel approaches to cancer therapy. Growth Horm IGF Res. 14 (4): 287-95.

Riedemann J, et al. (2006) IGF1R signalling and its inhibition. Endocr Relat Cancer. 13 Suppl 1: 33-43.

Gualco E, et al. (2009) IGF-IR in neuroprotection and brain tumors. Front Biosci. 14: 352-75.

Annenkov A. (2009) The insulin-like growth factor (IGF) receptor type 1 (IGF1R) as an essential component of the signalling network regulating neurogenesis. Mol Neurobiol. 40 (3): 195-215.

Catalog Number:CGD837-NM