Rhesus IFNAR2/IFNABR Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001092342.2

RefSeq ORF Size

1551bp

Gene Synonym

IFNAR2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus interferon (alpha, beta and omega) receptor 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interferon-alpha/beta receptor beta chain (IFNAR2) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Initial cell-surface IFNAR2 expression at diagnosis assessed by flow cytometry widely distributed but showed overall significantly higher expression in CML patients when compared with normal controls. In 15 fresh patients who subsequently received IFNα therapy, IFNAR2 expression at diagnosis was significantly higher in cytogenetic good responders than in poor responders. Down-regulation of IFNAR2 expression during IFNα therapy was observed only in good responders but not in poor responders. The encoded protein also functions as an antiviral factor. IFNAR2 may associate with IFNAR1 to form the type I interferon receptor. This protein serves as a receptor for interferons alpha and beta. IFNAR2 is also involved in IFN-mediated STAT1, STAT2 and STAT3 activation. Isoform 1 and isoform 2 are directly involved in signal transduction due to their association with the TYR kinase, JAK1. Isoform 3 is a potent inhibitor of type I IFN receptor activity. Following binding of IFNα2, IFNAR2 is internalized, but, instead of being routed towards degradation as it is when complexed to IFNβ, it recycles back to the cell surface.

References

Ito K, et al. (2004) Initial expression of interferon alpha receptor 2 (IFNAR2) on CD34-positive cells and its down-regulation correlate with clinical response to interferon therapy in chronic myelogenous leukemia. Eur J Haematol. 73(3): 191-205.

Kim SH, et al. (1997) Mammalian type I interferon receptors consists of two subunits: IFNaR1 and IFNaR2. Gene. 196(1-2): 279-86.

Saleh AZ, et al. (2004) Regulated proteolysis of the IFNaR2 subunit of the interferon-alpha receptor. Oncogene. 23(42): 7076-86.

Catalog Number:CGD817-NF