Rat HVEM/TNFRSF14/CD270 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001015034.1

RefSeq ORF Size

837bp

Gene Synonym

TNFRSF14

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 14 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Herpesvirus entry mediator (HVEM), also referred to as TNFRSF14, TR2 (TNF receptor-like molecule) and ATAR (another TRAF-associated receptor), is a member of type I transmembrane protein belonging to the TNF-receptor superfamily. It is expressed on many immune cells, including T and B cells, NK cells, monocytes, and neutrophils. Two TNF superfamily ligands lymphotoxin α (TNF-β) and LIGHT (TNFSF14) are identified as cellular ligands for HVEM and initiate the positive signaling. However, recent studies have revealed that HVEM is also involved in the unique inhibitory signaling pathway for T cells through activating tyrosine phosphorylation of the immunoreceptor tyrosine-based inhibitory motif (ITIM) in B and T lymphocyte attenuator (BTLA). HVEM provides a stimulatory signal following engagement with LIGHT (TNFSF14) on T cells. In contrast, it can also provide an inhibitory signal to T cells when it binds the B and T lymphocyte attenuator (BTLA), a ligand member of the Immunoglobulin (Ig) superfamily. Thus, HVEM may be viewed as a molecular switch, capable of facilitating both stimulatory and inhibitory cosignaling in T cells. Substantial evidence from both human disease and from experimental mouse models has indicated that dysregulation of the LIGHT-HVEM-BTLA cosignaling pathway can cause inflammation in the lung and in mucosal tissues.

References

Murphy KM, et al. (2006) Balancing co-stimulation and inhibition with BTLA and HVEM. Nat Rev Immunol. 6(9): 671-81.

Heo SK, et al. (2007) HVEM signaling in monocytes is mediated by intracellular calcium mobilization. J Immunol. 179(9): 6305-10.

Steinberg MW, et al. (2008) A crucial role for HVEM and BTLA in preventing intestinal inflammation. J Exp Med. 205(6): 1463-76.

Pasero C, et al. (2009) A role for HVEM, but not lymphotoxin-beta receptor, in LIGHT-induced tumor cell death and chemokine production. Eur J Immunol. 39(9): 2502-14.

Cheung TC. Modulation of T cell proliferation through the LIGHT-HVEM-BTLA cosignaling pathway. Recent Pat DNA Gene Seq. 3(3): 177-82.

Catalog Number:CGD765-CY