Rat HSPA8/HSC70 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

BC061547.1

RefSeq ORF Size

1986 bp

Gene Synonym

Hsc70

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat heat shock 70kDa protein 8 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

KpnI + XbaI(6kb+1.99kb)

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

HSPA8, also known as HSC70, is a member of the heat shock protein family due to homology with other heat shock proteins. The heat shock protein 70 family is comprised by both heat-inducible and constitutively expressed members. The latter are called heat-shock cognate proteins. HSPA8 belongs to the heat-shock cognate subgroup. Members of the human heat-shock protein multigene family have several highly conserved proteins with structural and functional properties in common, but vary in the extent of their inducibility in response to metabolic stress. HSPA8 is constitutively expressed and performs functions related to normal cellular processes. This protein binds to nascent polypeptides to facilitate correct protein folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Two alternatively spliced variants have been characterized to date. HSPA8 acts as a repressor of transcriptional activation. It inhibits the transcriptional coactivator activity of CITED1 on Smad-mediated transcription. Isoform 2 may function as an endogenous inhibitory regulator of HSC70 by competing the co-chaperones. It also is a ATPase that works with auxilin to remove clathrin coated vesicles. In neurons, synaptojanin is also an important protein involved in vesicle uncoating.

References

Santacruz H, et al. (1997) Molecular characterization of a heat shock cognate cDNA of zebrafish, hsc70, and developmental expression of the corresponding transcripts. Dev Genet. 21:223-33.

Harhay G P, et al. (2005) Characterization of 954 bovine full-CDS cDNA sequences. BMC Genomics. 6: 166.

Goldfarb S, et al. (2006) Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc Natl Acad Sci. 103(15):5817-22.

Catalog Number:CGD750-NY