Rat HGF/Hepatocyte Growth Factor Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:CGD561-NH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2187bp
Gene Synonym
HPTA
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat hepatocyte growth factor Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Hepatocyte growth factor, also known as HGF, contains 4 kringle domains, 1 PAN domain and 1 peptidase S1 domain. It belongs to the peptidase S1 family, plasminogen subfamily. Hepatocyte growth factor is secreted by mesenchymal cellsas a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor, and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. HGF is a potent mitogen for mature parenchymal hepatocyte cells, seems to be an hepatotrophic factor, and acts as growth factor for a broad spectrum of tissues and cell types. HGF has no detectable protease activity. Defects in hepatocyte growth factor are the cause of deafness autosomal recessive type 39. A form of profound prelingual sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.
References
  • Naldini L, et al. (1991) Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET receptor. EMBO J. 10(10):2867-78.
  • Comoglio, et al. (1993) Structure, biosynthesis and biochemical properties of the HGF receptor in normal and malignant cells. 65:131-65.
  • Hahn W, et al. (2011) Enhanced cardioprotective effects by coexpression of two isoforms of hepatocyte growth factor from naked plasmid DNA in a rat ischemic heart disease model. The Journal of Gene Medicine. 13(10):549-55.
  • Bottaro DP, et al. (1991) Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science. 251(4995):802-4.
  • TOP