Rat Hemojuvelin / HFE2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_001012080.1

RefSeq ORF Size

1269bp

Gene Synonym

Rgmc, MGC105910, Hfe2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat hemochromatosis type 2 (juvenile) homolog (human) Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Hemojuvelin, also known as HFE2, is a membrane-bound and soluble protein which belongs to the repulsive guidance molecule (RGM) family. It is known that RGMs function through Neogenin, a homologue of the Netrin receptor deleted in colon cancer. In mammals, RGM family consists of three glycoproteins which have discrete expression patterns and functions (RGM-A, RGM-B, and RGM-C). Hemojuvelin is expressed in adult and fetal liver, heart, and skeletal muscle. Hemojuvelin acts as a bone morphogenetic protein (BMP) coreceptor. Enhancement of BMP signaling regulates hepcidin (HAMP) expression and iron metabolism. It plays a key role in iron metabolism. Hemojuvelin represents the cellular receptor for hepcidin. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. Defects in hemojuvelin are the cause of hemochromatosis type 2A, also known as juvenile hemochromatosis (JH).

References

Papanikolaou G, et al. (2004) Mutations in HFE2 cause iron overload in chromosome 1q-linked juvenile hemochromatosis. Nat Genet. 36(1):77-82.

Babitt JL, et al. (2006) Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression. Nat Genet. 38(5):531-9.

Zhang AS, et al. (2008) Neogenin-mediated hemojuvelin shedding occurs after hemojuvelin traffics to the plasma membrane. J Biol Chem. 283(25):17494-502.

Catalog Number:CGD523-CO