Rhesus GFRA3 Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:CGD088-CH

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1218bp
Gene Synonym
GFRA3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus GDNF family receptor alpha 3 Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 3 (GFRA3) or GDNFRa3 is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA3 / GDNFRa3 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. The neurotrophic growth factor artemin binds selectively to GDNF family receptor α3 (GFRA3 / GDNFRa3), forming a molecular complex with the co-receptor RET which mediates downstream signaling. This signaling pathway has been demonstrated to play an important role in the survival and maintenance of nociceptive sensory neurons and in the development of sympathetic neurons.
References
  • Widenfalk J, et al. (2000) Neurturin, RET, GFRalpha-1 and GFRalpha-2, but not GFRalpha-3, mRNA are expressed in mice gonads. Cell Tissue Res. 299(3): 409-15.
  • Li J, et al. (2009) Autocrine regulation of early embryonic development by the artemin-GFRA3 (GDNF family receptor-alpha 3) signaling system in mice. FEBS Lett. 583(15): 2479-85.
  • Yang C, et al. (2006) Distribution of GDNF family receptor alpha3 and RET in rat and human non-neural tissues. J Mol Histol. 37(1-2): 69-77.
  • TOP