Cynomolgus Galactolipase / PNLIPRP2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:CGC989-NM

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1413bp
Gene Synonym
PNLIPRP2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus pancreatic lipase-related protein 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Galactolipase, also known as PNLIPRP2, is a lipase with broad substrate specificity. It can hydrolyze both phospholipids and galactolipids. Galactolipase acts preferentially on monoglycerides, phospholipids and galactolipids. It also hydrolyses milk fat with a lower catalytic efficiency. The expressed galactolipase shows a lipolytic activity that is, however, only marginally dependent on the presence of colipase. The lipolytic activity of pancreatic extracts and human pancreatic juice on Labrasol is mainly due to the combined action of carboxyl ester hydrolase and galactolipase.
References
  • Andersson EL, et al. (2011) BSSL and PLRP2: key enzymes for lipid digestion in the newborn examined using the Caco-2 cell line. J Lipid Res. 52(11):1949-56.
  • Xiao X, et al. (2011) Pancreatic lipase-related protein-2 (PLRP2) can contribute to dietary fat digestion in human newborns. J Biol Chem. 286(30):26353-63.
  • Alves BN, et al. (2009) Lipid-dependent cytotoxicity by the lipase PLRP2 and by PLRP2-positive cytotoxic T lymphocytes (CTLs). Cell Biochem Funct. 27(5):296-308.
  • TOP