Rat Erythropoietin/EPO Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:CGC591-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
579bp
Gene Synonym
Epo
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat erythropoietin Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Erythropoietin is a member of the EPO / TPO family. It is a secreted, glycosylated cytokine composed of four alpha helical bundles. Erythropoietin can be found in the plasma and regulates red cell production by promoting erythroid differentiation and initiating hemoglobin synthesis. It also has neuroprotective activity against a variety of potential brain injuries and antiapoptotic functions in several tissue types. Erythropoietin is the principal hormone involved in the regulation of erythrocyte differentiation and the maintenance of a physiological level of circulating erythrocyte mass. It is produced by kidney or liver of adult mammals and by liver of fetal or neonatal mammals. Genetic variation in erythropoietin is associated with susceptbility to microvascular complications of diabetes type 2. These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. It has a longer circulating half-life in vivo. Erythropoietin is being much misused as a performance-enhancing drug in endurance athletes.
References
  • Jelkmann W, et al. (2007) Erythropoietin after a century of research: younger than ever. Eur J Haematol. 78 (3):183-205.
  • Miyake T, et al. (1997) Purification of human erythropoietin. J Biol Chem. 252(15):5558-64.
  • Haroon ZA, et al. (2003) A novel role for erythropoietin during fibrin-induced wound-healing response. Am J Pathol. 163(3):993-1000.
  • Siren AL, et al. (2001) Erythropoietin prevents neuronal apoptosis after cerebral ischemia and metabolic stress. Proc Natl Acad Sci. 98(7):4044-9.
  • TOP