Rhesus EpCAM/TROP-1/TACSTD1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:CGC532-NO

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
945bp
Gene Synonym
Ep-CAM; TACSTD1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus epithelial cell adhesion molecule Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type â… transmembrane glycoprotein composed of an extracellular domain with two EGF-Like repeats and a cystenin-rich region, a transmembrane domain and a cytoplasmic domain. It modulates cell adhesion and proliferation. Its overexpression has been detected in many epithelial tumours and has been associated with high stage, high grade and a worse survival in some tumour types. EpCAM has been shown to function as a calcium-independent homophilic cell adhesion molecule that does not exhibit any obvious relationship to the four known cell adhesion molecule superfamilies. However, recent insights have revealed that EpCAM participates in not only cell adhesion, but also in proliferation, migration and differentiation of cells. In addition, recent study revealed that EpCAM is the Wnt-beta-catenin signaling target gene and may be used to facilitate prognosis. It has oncogenic potential and is activated by release of its intracellular domain, which can signal into the cell nucleus by engagement of elements of the wnt pathway.
References
  • Brunner A, et al. (2008) EpCAM is predominantly expressed in high grade and advanced stage urothelial carcinoma of the bladder. J Clin Pathol. 61(3):307-10.
  • Trzpis M, et al. (2008) EpCAM in morphogenesis. Front Biosci. 13: 5050-5.
  • Munz M, et al. (2009) The emerging role of EpCAM in cancer and stem cell signaling. Cancer Res. 69(14): 5627-9.
  • Carpenter G, et al. (2009) EpCAM: another surface-to-nucleus missile. Cancer Cell. 15(3): 165-6.
  • TOP