Rat ENPEP / Aminopeptidase A Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:CGC515-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2838bp
Gene Synonym
Enpep
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat glutamyl aminopeptidase Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ENPEP, also known as aminopeptidase A, is a member of the peptidase M1 family. Members of this family are involved in response to cadmium ion and proteolysis. They located in 6 components and are expressed in 26 plant structures. ENPEP is expressed by epithelial cells of the proximal tubule cells and the glomerulus of the nephron. It also can be detected in a variety of other tissues. ENPEP probably plays a role in regulating growth and differentiation of early B-lineage cells. It also may play a role in the catabolic pathway of the renin-angiotensin system. ENPEP is a zinc-dependent membrane-bound aminopeptidase that catalyzes the cleavage of glutamatic and aspartatic amino acid residues from the N-terminus of polypeptides. It degrades vasoconstricting angiotensin II into angiotensin III and therefore helps to regulate blood pressure.
References
  • Speth RC, et al. (2008) The significance of brain aminopeptidases in the regulation of the actions of angiotensin peptides in the brain. Heart Fail Rev. 13(3):299-309.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Pérez I, et al. (2009) Increased APN/CD13 and acid aminopeptidase activities in head and neck squamous cell carcinoma. Head Neck. 31(10):1335-40.
  • TOP