Rhesus E-Selectin/CD62e/SELE Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:CGC350-NM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1833bp
Gene Synonym
SELE
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus selectin E Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
E-selectin, also known as endothelial leukocyte adhesion molecule-1 (ELAM-1) and CD62E, is an inducible adhesion molecule that is expressed on the surfaces of stimulated vascular endothelial cells and is sometimes involved in cancer cell metastasis. E-selectin exhibits a complex mosaic structure consisting of a large extracellular region comprised of a lectin domain, an EGF-like domain, and a short consensus repeat (SCR) domain, followed by a transmembrane region and a relatively short (32 aa) cytoplasmic tail. As a member of the LEC-CAM or selectin family, E-selectin recognises and binds to sialylated carbohydrates including members of the Lewis X and Lewis A families found on monocytes, granulocytes, and T-lymphocytes. E-selectin supports rolling and stable arrest of leukocytes on activated vascular endothelium, and furthermore, it was indicated that it can also transduce an activating stimulus via the MAPK cascade into the endothelial cell during leukocyte adhesion. E-selectin regulates adhesive interactions between certain blood cells and endothelium. The soluble form of E selectin (sE-selectin) is a marker of endothelial activation, and has a potential role in the pathogenesis of cardiovascular disease as raised levels have been found in hypertension, diabetes and hyperlipidemia, although its association in established atherosclerosis disease and its value as a prognostic factor is more controversial. soluble E-selectin is inversely associated with the muscular component of the left ventricle, thereby suggesting that the lack of such a reparative factor may be associated with cardiac remodeling in end-stage renal disease (ESRD) patients. In addition, this adhesion molecule appears to be involved in the pathogenesis of atherosclerosis.
References
  • Roldn V, et al. (2003) Soluble E-selectin in cardiovascular disease and its risk factors. A review of the literature. Thromb Haemost. 90(6): 1007-20.
  • Kawase J, et al. (2009) Increase in E-selectin expression in umbilical vein endothelial cells by anticancer drugs and inhibition by cimetidine. Oncol Rep. 22(6): 1293-7.
  • Matsumoto K, et al. (2010) Soluble adhesion molecule E-selectin predicts cardiovascular events in Japanese patients with type 2 diabetes mellitus. Metabolism. 59(3): 320-4.
  • Stancanelli B, et al. (2010) Soluble e-selectin is an inverse and independent predictor of left ventricular wall thickness in end-stage renal disease patients. Nephron Clin Pract. 114(1): c74-80.
  • TOP