Rat DDR2/CD167b Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:CGC116-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2565bp
Gene Synonym
Tyro10, Ddr2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat discoidin domain receptor tyrosine kinase 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases associated with cell proliferation and tumor metastasis, and collagen, identified as a ligand for DDR2, up-regulates matrix metallloproteinase 1 (MMP-1) and MMP-2 expression in cellular matrix. DDR2/CD167b was found to recognise the triple-helical region of collagen X as well as the NC1 domain. Binding to the collagenous region was dependent on the triple-helical conformation. DDR2/CD167b autophosphorylation was induced by the collagen X triple-helical region but not the NC1 domain, indicating that the triple-helical region of collagen X contains a specific DDR2 binding site that is capable of receptor activation. DDR2/CD167b is induced during stellate cell activation and implicate the phosphorylated receptor as a mediator of MMP-2 release and growth stimulation in response to type I collagen. Moreover, type I collagen-dependent upregulation of DDR2/CD167b expression establishes a positive feedback loop in activated stellate cells, leading to further proliferation and enhanced invasive activity.
References
  • Olaso E, et al. (2001) DDR2 receptor promotes MMP-2-mediated proliferation and invasion by hepatic stellate cells. J Clin Invest. 108(9): 1369-78.
  • Zhang W, et al. (2006) Expression of discoidin domain receptor 2 (DDR2) extracellular domain in pichia pastoris and functional analysis in synovial fibroblasts and NIT3T3 cells. Mol Cell Biochem. 290(1-2): 43-53.
  • Leitinger B, et al. (2006) The discoidin domain receptor DDR2 is a receptor for type X collagen. Matrix Biol. 25(6): 355-64.
  • Leitinger B, et al. (2004) The D2 period of collagen II contains a specific binding site for the human discoidin domain receptor, DDR2. J Mol Biol. 344(4): 993-1003.
  • TOP