Rhesus CXCL9 / MIG Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:CGB949-CM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
378bp
Gene Synonym
CXCL9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus chemokine (C-X-C motif) ligand 9 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Chemokine (C-X-C motif) ligand 9 (CXCL9), also known as Monokine induced by gamma interferon (MIG), is a small cytokine belonging to the CXC chemokine family. The function of this chemokine has not been specifically defined; however, it is thought to be involved in T cell trafficking. CXCL9/MIG functions as one of the three ligands of chemokine receptor CXCR3 which is a G protein-coupled receptor found predominantly on T cells. CXCL9/MIG, together with CXCL10 and CXCL11, may activate CXCR3 by binding to it. CXCL9 serves as a cytokine that affects the growth, movement, or activation state of cells that participate in immune and inflammatory response. It has been observed that tumour endothelial cells secrete high levels of CXCL9 in all, and CXCL10 in most melanoma metastases. Experiment data represent novel mechanisms by which tumour cells in melanoma metastases might use the chemokine-expressing endothelium to leave the tumour and eventually to form additional metastases at distinct sites. Experiment results also improved that CXCL9/MIG plays an important role in CD4+ T lymphocyte recruitment and development of CAV, MOMA-2+ macrophages are the predominant recipient-derived source of CXCL9/MIG, and recipient CD4 lymphocytes are necessary for sustained CXCL9/MIG production and CAV development in this model. Neutralization of the chemokine CXCL9/MIG may have therapeutic potential for the treatment of chronic rejection after heart transplantation.
References
  • Ruehlmann JM, et al. (2001) MIG (CXCL9) chemokine gene therapy combines with antibody-cytokine fusion protein to suppress growth and dissemination of murine colon carcinoma. Cancer Res. 61(23): 8498-503.
  • Belperio JA, et al. (2003) Role of CXCL9/CXCR3 chemokine biology during pathogenesis of acute lung allograft rejection. J Immunol. 171(9): 4844-52.
  • Colvin RA, et al. (2004) Intracellular domains of CXCR3 that mediate CXCL9, CXCL10, and CXCL11 function. J Biol Chem. 279(29): 30219-27.
  • Valbuena G, et al. (2003) Expression analysis of the T-cell-targeting chemokines CXCL9 and CXCL10 in mice and humans with endothelial infections caused by rickettsiae of the spotted fever group. Am J Pathol. 163(4): 1357-69.
  • TOP